Are you looking for read ebook online? Search for your book and save it on your Kindle device, PC, phones or tablets. Download Genetic Takeover And The Mineral Origins Of Life PDF full book. Access full book title Genetic Takeover And The Mineral Origins Of Life.
| Author | : Alexander Graham Cairns-Smith |
| Publisher | : |
| Total Pages | : 477 |
| Release | : 1982 |
| Genre | : Science |
| ISBN | : 9780521233125 |
Three key ideas replace the notion that a primordial soup of organic molecules was essential in this explanation of how life on Earth evolved.
| Author | : AG. Cairns-Smith |
| Publisher | : |
| Total Pages | : |
| Release | : 1982 |
| Genre | : |
| ISBN | : |
| Author | : A. G. Cairns-Smith |
| Publisher | : |
| Total Pages | : 477 |
| Release | : 1987 |
| Genre | : Science |
| ISBN | : 9780521346825 |
Paper reprint of the 1982 edition.
| Author | : Alexander Graham Cairns-Smith |
| Publisher | : CUP Archive |
| Total Pages | : 216 |
| Release | : 1986-12-18 |
| Genre | : Science |
| ISBN | : 9780521324083 |
This volume is the edited proceedings of a conference seeking to clarify the possible role of clays in the origin of life on Earth. At the heart of the problem of the origin of life lie fundamental questions such as: What kind of properties is a model of a primitive living system required to exhibit and what would its most plausible chemical and molecular makeup be? Answers to these questions have traditionally been sought in terms of properties that are held to be common to all contemporary organisms. However, there are a number of different ideas both on the nature and on the evolutionary priority of 'common vital properties', notably those based on protoplasmic, biochemical and genetic theories of life. This is therefore the first area for consideration in this volume and the contributors then examine to what extent the properties of clay match those required by the substance which acted as the template for life.
| Author | : National Research Council |
| Publisher | : National Academies Press |
| Total Pages | : 116 |
| Release | : 2007-07-26 |
| Genre | : Science |
| ISBN | : 030910484X |
The search for life in the solar system and beyond has to date been governed by a model based on what we know about life on Earth (terran life). Most of NASA's mission planning is focused on locations where liquid water is possible and emphasizes searches for structures that resemble cells in terran organisms. It is possible, however, that life exists that is based on chemical reactions that do not involve carbon compounds, that occurs in solvents other than water, or that involves oxidation-reduction reactions without oxygen gas. To assist NASA incorporate this possibility in its efforts to search for life, the NRC was asked to carry out a study to evaluate whether nonstandard biochemistry might support life in solar system and conceivable extrasolar environments, and to define areas to guide research in this area. This book presents an exploration of a limited set of hypothetical chemistries of life, a review of current knowledge concerning key questions or hypotheses about nonterran life, and suggestions for future research.
| Author | : John Maynard Smith |
| Publisher | : Oxford University Press, USA |
| Total Pages | : 200 |
| Release | : 1999 |
| Genre | : Language Arts & Disciplines |
| ISBN | : |
To create this landmark work--a brilliant, state-of-the-art account of how life evolved on Earth--Smith and Szathmary have completely rewritten their "Major Transitions in Evolution" to bring their ideas to a wider audience of general readers. 42 illustrations.
| Author | : Geoffrey Zubay |
| Publisher | : Elsevier |
| Total Pages | : 585 |
| Release | : 2000-01-18 |
| Genre | : Science |
| ISBN | : 0080497616 |
Origins of Life on the Earth and in the Cosmos, Second Edition, suggests answers to the age-old questions of how life arose in the universe and how it might arise elsewhere. This thorough revision of a very successful text describes key events in the evolution of living systems, starting with the creation of an environment suitable for the origins of life. Whereas one may never be able to reconstruct the precise pathway that led to the origin of life on earth, one can certainly make some plausible reconstructions of it. Such discussions have greatly expanded our understanding of the principles of chemical evolution and how they compare and contrast with the principles of biological evolution. The text is strong on biochemistry and its recent applications to origins' research. Provides an excellent review of basic biochemistry an evolution Written in a clear, concise style for scientists, students, and readers interested in a scientific inquiry into the origins of life Written by an authority in the field, and brought fully up-to-date in light of new research Pulls together valuable information not found in a single source Organized and presented in a manner conductive for use in a college course Heavily illustrated to make difficult concepts concrete
| Author | : Adam Rutherford |
| Publisher | : Penguin UK |
| Total Pages | : 272 |
| Release | : 2013-04-04 |
| Genre | : Science |
| ISBN | : 0141970227 |
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
| Author | : André Brack |
| Publisher | : Cambridge University Press |
| Total Pages | : 432 |
| Release | : 1998-12-28 |
| Genre | : Science |
| ISBN | : 9780521564755 |
This 199 book reviews discoveries in astronomy, paleontology, biology and chemistry to help us to understand the likely origin of life on Earth.
| Author | : J. Mayo Greenberg |
| Publisher | : Springer Science & Business Media |
| Total Pages | : 429 |
| Release | : 2012-12-06 |
| Genre | : Science |
| ISBN | : 9401119368 |
This volume contains the lectures presented at the second course of the International School of Space Chemistry held in Erice (Sicily) from October 20 - 30 1991 at the "E. Majorana Centre for Scientific Culture". The course was attended by 58 participants from 13 countries. The Chemistry of Life's Origins is well recognized as one of the most critical subjects of modem chemistry. Much progress has been made since the amazingly perceptive contributions by Oparin some 70 years ago when he first outlined a possible series of steps starting from simple molecules to basic building blocks and ultimate assembly into simple organisms capable of replicating, catalysis and evolution to higher organisms. The pioneering experiments of Stanley Miller demonstrated already forty years ago how easy it could have been to form the amino acids which are critical to living organisms. However we have since learned and are still learning a great deal more about the primitive conditions on earth which has led us to a rethinking of where and how the condition for prebiotic chemical processes occurred. We have also learned a great deal more about the molecular basis for life. For instance, the existence of DNA was just discovered forty years ago.
